NM_000173.7:c.1321_1359delTCAGAGCCCGCCCCCAGCCCGACCACCCCGGAGCCCACC
Variant summary
Our verdict is Likely benign. The variant received -6 ACMG points: 2P and 8B. PM4BP6_Very_Strong
The NM_000173.7(GP1BA):c.1321_1359delTCAGAGCCCGCCCCCAGCCCGACCACCCCGGAGCCCACC(p.Ser441_Thr453del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_000173.7 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- congenital myasthenic syndromeInheritance: AR Classification: DEFINITIVE Submitted by: Illumina
- congenital myasthenic syndrome 4AInheritance: AD, AR Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), PanelApp Australia
- congenital myasthenic syndrome 4BInheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), PanelApp Australia
- congenital myasthenic syndrome 4CInheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
- postsynaptic congenital myasthenic syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -6 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| GP1BA | NM_000173.7 | c.1321_1359delTCAGAGCCCGCCCCCAGCCCGACCACCCCGGAGCCCACC | p.Ser441_Thr453del | conservative_inframe_deletion | Exon 2 of 2 | ENST00000329125.6 | NP_000164.5 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| GP1BA | ENST00000329125.6 | c.1321_1359delTCAGAGCCCGCCCCCAGCCCGACCACCCCGGAGCCCACC | p.Ser441_Thr453del | conservative_inframe_deletion | Exon 2 of 2 | 1 | NM_000173.7 | ENSP00000329380.5 | ||
| CHRNE | ENST00000649830.1 | c.-888+388_-888+426delCGGGGTGGTCGGGCTGGGGGCGGGCTCTGAGGTGGGCTC | intron_variant | Intron 1 of 10 | ENSP00000496907.1 |
Frequencies
GnomAD3 genomes AF: 0.000169 AC: 2AN: 11854Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000260 AC: 8AN: 308274Hom.: 0 AF XY: 0.0000259 AC XY: 4AN XY: 154716 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000169 AC: 2AN: 11854Hom.: 0 Cov.: 0 AF XY: 0.000177 AC XY: 1AN XY: 5652 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not specified Benign:2
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at