NM_000179.3:c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000179.3(MSH6):​c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC​(p.His388ArgfsTer7) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. H388H) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

MSH6
NM_000179.3 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 9.70

Publications

0 publications found
Variant links:
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
FBXO11 Gene-Disease associations (from GenCC):
  • intellectual developmental disorder with dysmorphic facies and behavioral abnormalities
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 2-47799084-T-TGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC is Pathogenic according to our data. Variant chr2-47799084-T-TGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC is described in ClinVar as Pathogenic. ClinVar VariationId is 525833.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH6NM_000179.3 linkc.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC p.His388ArgfsTer7 frameshift_variant, stop_gained Exon 4 of 10 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH6ENST00000234420.11 linkc.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC p.His388ArgfsTer7 frameshift_variant, stop_gained Exon 4 of 10 1 NM_000179.3 ENSP00000234420.5 P52701-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
34
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Lynch syndrome 5 Pathogenic:1
Aug 11, 2023
Myriad Genetics, Inc.
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Jun 23, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

ClinVar contains an entry for this variant (Variation ID: 525833). This sequence change creates a premature translational stop signal (p.His388Argfs*7) in the MSH6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MSH6 are known to be pathogenic (PMID: 18269114, 24362816). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.7
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553412502; hg19: chr2-48026223; API