NM_000179.3:c.3930_3970dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000179.3(MSH6):c.3930_3970dupGGAAGTTATTCAAAAGGGACATAGAAAAGCAAGAGAATTTG(p.Glu1324GlyfsTer17) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E1324E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000179.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- intellectual developmental disorder with dysmorphic facies and behavioral abnormalitiesInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 35
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Lynch syndrome 5 Pathogenic:1
This variant is considered likely pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
This sequence change creates a premature translational stop signal (p.Glu1324Glyfs*17) in the MSH6 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 37 amino acid(s) of the MSH6 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. ClinVar contains an entry for this variant (Variation ID: 237202). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts a region of the MSH6 protein in which other variant(s) (p.Leu1330Valfs*12) have been determined to be pathogenic (PMID: 14520694, 15236168, 16237223, 19851887, 21155762). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.3930_3970dup41 variant, located in coding exon 9 of the MSH6 gene, results from a duplication of 41 nucleotides at positions 3930 to 3970, causing a translational frameshift with a predicted alternate stop codon (p.E1324Gfs*17). This alteration occurs at the 3' terminus of theMSH6 gene, is not expected to trigger nonsense-mediated mRNA decay, and only impacts the last 2.4% of the protein. However, premature stop codons are typically deleterious in nature and the impacted region is critical for protein function (Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). Based on the majority of available evidence to date, this variant is likely to be pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at