NM_000179.3:c.3939_3959dupTCAAAAGGGACATAGAAAAGC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000179.3(MSH6):c.3939_3959dupTCAAAAGGGACATAGAAAAGC(p.Ala1320_Arg1321insGlnLysGlyHisArgLysAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000179.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 35
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Lynch syndrome 5 Uncertain:2
This variant is classified as a variant of uncertain significance as there is insufficient evidence to determine its impact on protein function and/or cancer risk. -
- -
Hereditary nonpolyposis colorectal neoplasms Uncertain:1
This variant, c.3939_3959dup, results in the insertion of 7 amino acid(s) of the MSH6 protein (p.Gln1314_Ala1320dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. ClinVar contains an entry for this variant (Variation ID: 548737). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.3939_3959dup21 variant (also known as p.Q1314_A1320dup), located in coding exon 9 of the MSH6 gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 3939 to 3959. This results in the duplication of 7 extra residues (QKGHRKA) between codons 1314 and 1320. This amino acid region is well conserved through mammals but not in all available vertebrate species. Based on the available evidence, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at