NM_000179.3:c.3939_3959dupTCAAAAGGGACATAGAAAAGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_000179.3(MSH6):​c.3939_3959dupTCAAAAGGGACATAGAAAAGC​(p.Ala1320_Arg1321insGlnLysGlyHisArgLysAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 32)

Consequence

MSH6
NM_000179.3 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:4

Conservation

PhyloP100: 1.23
Variant links:
Genes affected
MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000179.3.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH6NM_000179.3 linkc.3939_3959dupTCAAAAGGGACATAGAAAAGC p.Ala1320_Arg1321insGlnLysGlyHisArgLysAla disruptive_inframe_insertion Exon 9 of 10 ENST00000234420.11 NP_000170.1 P52701-1Q3SWU9

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH6ENST00000234420.11 linkc.3939_3959dupTCAAAAGGGACATAGAAAAGC p.Ala1320_Arg1321insGlnLysGlyHisArgLysAla disruptive_inframe_insertion Exon 9 of 10 1 NM_000179.3 ENSP00000234420.5 P52701-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
35
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Lynch syndrome 5 Uncertain:2
Mar 27, 2023
Myriad Genetics, Inc.
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is classified as a variant of uncertain significance as there is insufficient evidence to determine its impact on protein function and/or cancer risk. -

Apr 10, 2017
Counsyl
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Hereditary nonpolyposis colorectal neoplasms Uncertain:1
Oct 22, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.3939_3959dup, results in the insertion of 7 amino acid(s) of the MSH6 protein (p.Gln1314_Ala1320dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. ClinVar contains an entry for this variant (Variation ID: 548737). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1
Feb 29, 2024
Ambry Genetics
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.3939_3959dup21 variant (also known as p.Q1314_A1320dup), located in coding exon 9 of the MSH6 gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 3939 to 3959. This results in the duplication of 7 extra residues (QKGHRKA) between codons 1314 and 1320. This amino acid region is well conserved through mammals but not in all available vertebrate species. Based on the available evidence, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553333670; hg19: chr2-48033727; API