NM_000193.4:c.1030_1050dupGCCTACGCGCCGCTCACGGCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_000193.4(SHH):​c.1030_1050dupGCCTACGCGCCGCTCACGGCC​(p.Ala350_Gln351insAlaTyrAlaProLeuThrAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

SHH
NM_000193.4 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: -0.0740
Variant links:
Genes affected
SHH (HGNC:10848): (sonic hedgehog signaling molecule) This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000193.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SHHNM_000193.4 linkc.1030_1050dupGCCTACGCGCCGCTCACGGCC p.Ala350_Gln351insAlaTyrAlaProLeuThrAla conservative_inframe_insertion Exon 3 of 3 ENST00000297261.7 NP_000184.1 Q15465

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SHHENST00000297261.7 linkc.1030_1050dupGCCTACGCGCCGCTCACGGCC p.Ala350_Gln351insAlaTyrAlaProLeuThrAla conservative_inframe_insertion Exon 3 of 3 1 NM_000193.4 ENSP00000297261.2 Q15465
SHHENST00000430104.5 linkc.302-3014_302-2994dupGCCTACGCGCCGCTCACGGCC intron_variant Intron 3 of 3 1 ENSP00000396621.1 C9JC48
SHHENST00000435425.1 linkn.302-2662_302-2642dupGCCTACGCGCCGCTCACGGCC intron_variant Intron 3 of 4 1 ENSP00000413871.1 F8WEH4
SHHENST00000441114.5 linkn.302-2592_302-2572dupGCCTACGCGCCGCTCACGGCC intron_variant Intron 3 of 4 1 ENSP00000410546.1 F8WB84

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
35
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Oct 05, 2015
Genetic Services Laboratory, University of Chicago
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554493741; hg19: chr7-155595932; API