NM_000238.4:c.3107_3127delGCGACGTGGAGAGCAGGCTGG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_000238.4(KCNH2):​c.3107_3127delGCGACGTGGAGAGCAGGCTGG​(p.Gly1036_Leu1042del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

KCNH2
NM_000238.4 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 7.24
Variant links:
Genes affected
KCNH2 (HGNC:6251): (potassium voltage-gated channel subfamily H member 2) This gene encodes a component of a voltage-activated potassium channel found in cardiac muscle, nerve cells, and microglia. Four copies of this protein interact with one copy of the KCNE2 protein to form a functional potassium channel. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000238.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
KCNH2NM_000238.4 linkc.3107_3127delGCGACGTGGAGAGCAGGCTGG p.Gly1036_Leu1042del disruptive_inframe_deletion Exon 13 of 15 ENST00000262186.10 NP_000229.1 Q12809-1Q15BH2A0A090N8Q0

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
KCNH2ENST00000262186.10 linkc.3107_3127delGCGACGTGGAGAGCAGGCTGG p.Gly1036_Leu1042del disruptive_inframe_deletion Exon 13 of 15 1 NM_000238.4 ENSP00000262186.5 Q12809-1
KCNH2ENST00000330883.9 linkc.2087_2107delGCGACGTGGAGAGCAGGCTGG p.Gly696_Leu702del disruptive_inframe_deletion Exon 9 of 11 1 ENSP00000328531.4 Q12809-2
KCNH2ENST00000684241.1 linkn.3940_3960delGCGACGTGGAGAGCAGGCTGG non_coding_transcript_exon_variant Exon 11 of 13

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Long QT syndrome Uncertain:1
Mar 18, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, this variant is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a KCNH2-related disease. This sequence change deletes 21 nucleotides from exon 13 of the KCNH2 mRNA (c.3107_3127del). This leads to the deletion of 7 amino acid residues in the KCNH2 protein (p.Gly1036_Leu1042del) but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1064792917; hg19: chr7-150644440; API