NM_000245.4:c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC

Variant names:

• chr7-116771970-CCGAGCTACTTTTCCAGAAGGTATATTT-C
• rs869320706
• NM_000245.4:c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_000245.4(MET):​c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC​(p.Arg1004_Asp1010delinsHis) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as risk factor (no stars). Synonymous variant affecting the same amino acid position (i.e. R1004R) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MET NM_000245.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: risk factor no assertion criteria provided O:1
• Conservation: PhyloP100: 9.33
• Publications: 2 publications found

Genes affected

MET (HGNC:7029): (MET proto-oncogene, receptor tyrosine kinase) This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]

MET Gene-Disease associations (from GenCC):

• hereditary papillary renal cell carcinoma

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• papillary renal cell carcinoma

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, ClinGen
• autosomal recessive nonsyndromic hearing loss 97

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• osteofibrous dysplasia

  Inheritance: AD Classification: SUPPORTIVE, LIMITED Submitted by: Orphanet, Ambry Genetics
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• arthrogryposis, distal, IIa 11

  Inheritance: AD, Unknown Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen
• complex neurodevelopmental disorder

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.03378864 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000245.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MET	NM_000245.4	MANE Select	c.3011_3028+9delGAGCTACTTTTCCAGAAGGTATATTTC	p.Arg1004_Asp1010delinsHis	splice_donor disruptive_inframe_deletion splice_region intron	Exon 14 of 21	NP_000236.2
	MET	NM_001127500.3		c.3065_3082+9delGAGCTACTTTTCCAGAAGGTATATTTC	p.Arg1022_Asp1028delinsHis	splice_donor disruptive_inframe_deletion splice_region intron	Exon 14 of 21	NP_001120972.1	P08581-2
	MET	NM_001324402.2		c.1721_1738+9delGAGCTACTTTTCCAGAAGGTATATTTC	p.Arg574_Asp580delinsHis	splice_donor disruptive_inframe_deletion splice_region intron	Exon 13 of 20	NP_001311331.1	B4DLF5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MET	ENST00000397752.8	TSL:1 MANE Select	c.3010_3028+8delCGAGCTACTTTTCCAGAAGGTATATTT	p.Arg1004ProfsTer379	frameshift splice_donor splice_region intron	Exon 14 of 21	ENSP00000380860.3	P08581-1
	MET	ENST00000318493.11	TSL:1	c.3064_3082+8delCGAGCTACTTTTCCAGAAGGTATATTT	p.Arg1022ProfsTer379	frameshift splice_donor splice_region intron	Exon 14 of 21	ENSP00000317272.6	P08581-2
	MET	ENST00000436117.3	TSL:1	n.*615_*633+8delCGAGCTACTTTTCCAGAAGGTATATTT		splice_region non_coding_transcript_exon	Exon 13 of 20	ENSP00000410980.2	P08581-3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: risk factor

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	-	Osteofibrous dysplasia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs869320706; hg19: chr7-116412024;