NM_000249.4:c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000249.4(MLH1):c.963_1014dupCATCCTGGAGCGGGTGCAGCAGCACATCGAGAGCAAGCTCCTGGGCTCCAAT(p.Ser339HisfsTer40) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,214 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000249.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 33
GnomAD4 exome Cov.: 31
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152214Hom.: 0 Cov.: 33 AF XY: 0.0000134 AC XY: 1AN XY: 74370
ClinVar
Submissions by phenotype
Colorectal cancer, hereditary nonpolyposis, type 2 Pathogenic:2
The c.963_1014dup (p.Ser339Hisfs*40) variant in the MLH1 gene is predicted to introduce a premature translation termination codon. This variant has never been reported in general population databases. Therefore, this c.963_1014dup (p.Ser339Hisfs*40) variant is classified as pathogenic. -
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
Lynch syndrome Pathogenic:1
- -
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in MLH1 are known to be pathogenic (PMID: 15713769, 24362816). This variant has not been reported in the literature in individuals with MLH1-related conditions. ClinVar contains an entry for this variant (Variation ID: 433861). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ser339Hisfs*40) in the MLH1 gene. It is expected to result in an absent or disrupted protein product. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at