NM_000251.3:c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000251.3(MSH2):c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG(p.His46GlyfsTer26) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. H46H) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene MSH2 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000251.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000251.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | MANE Select | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 16 | NP_000242.1 | P43246-1 | ||
| MSH2 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 18 | NP_001393603.1 | ||||
| MSH2 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 18 | NP_001393560.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | TSL:1 MANE Select | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 16 | ENSP00000233146.2 | P43246-1 | ||
| MSH2 | TSL:1 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 16 | ENSP00000384199.1 | E9PHA6 | ||
| MSH2 | c.136_164delCACGGCGAGGACGCGCTGCTGGCCGCCCG | p.His46GlyfsTer26 | frameshift | Exon 1 of 17 | ENSP00000588166.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at