NM_000251.3:c.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000251.3(MSH2):c.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC(p.Ala70IlefsTer4) variant causes a frameshift, splice donor, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P69P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000251.3 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, G2P
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MSH2 | NM_000251.3 | c.207_211+42delGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCCGGGGCC | p.Ala70IlefsTer4 | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 1 of 16 | ENST00000233146.7 | NP_000242.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MSH2 | ENST00000233146.7 | c.201_211+36delGGGGCCGGCAGGTGAGGGCCGGGACGGCGCGTGCTGGGGAGGGACCC | p.Gly68IlefsTer4 | frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant | Exon 1 of 16 | 1 | NM_000251.3 | ENSP00000233146.2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Lynch syndrome 1 Pathogenic:1
This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function.
Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. ClinVar contains an entry for this variant (Variation ID: 455540). This variant has not been reported in the literature in individuals affected with MSH2-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of part of exon 1 of the MSH2 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816).
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.207_211+42del47 variant results from a deletion of 47 nucleotides between positions c.207 and c.211+42 and involves the canonical splice donor site after coding exon 1 of the MSH2 gene. This variant has been identified in probands whose Lynch syndrome-associated tumor demonstrated loss of MSH2/MSH6 expression by immunohistochemistry and/or high microsatellite instability (Li S et al. J. Med. Genet. 2020 Jan;57:62-69; Ambry internal data). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). The canonical splice donor site is well conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice donor site and will and will result in the creation or strengthening of a novel splice donor site; however, direct evidence is insufficient at this time (Ambry internal data). Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at