NM_000251.3:c.269_290dupAAGATCTTCTTCTGGTTCGTCA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000251.3(MSH2):c.269_290dupAAGATCTTCTTCTGGTTCGTCA(p.Tyr98ArgfsTer9) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. Q97Q) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000251.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Lynch syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
- Lynch syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
- Muir-Torre syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Genomics England PanelApp
- mismatch repair cancer syndrome 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- mismatch repair cancer syndrome 2Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- ovarian cancerInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- malignant pancreatic neoplasmInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- prostate cancerInheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
- rhabdomyosarcomaInheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
- breast cancerInheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
- hereditary breast carcinomaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000251.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | NM_000251.3 | MANE Select | c.269_290dupAAGATCTTCTTCTGGTTCGTCA | p.Tyr98ArgfsTer9 | frameshift | Exon 2 of 16 | NP_000242.1 | P43246-1 | |
| MSH2 | NM_001406674.1 | c.269_290dupAAGATCTTCTTCTGGTTCGTCA | p.Tyr98ArgfsTer9 | frameshift | Exon 2 of 18 | NP_001393603.1 | |||
| MSH2 | NM_001406631.1 | c.269_290dupAAGATCTTCTTCTGGTTCGTCA | p.Tyr98ArgfsTer9 | frameshift | Exon 2 of 18 | NP_001393560.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH2 | ENST00000233146.7 | TSL:1 MANE Select | c.269_290dupAAGATCTTCTTCTGGTTCGTCA | p.Tyr98ArgfsTer9 | frameshift | Exon 2 of 16 | ENSP00000233146.2 | P43246-1 | |
| MSH2 | ENST00000406134.5 | TSL:1 | c.269_290dupAAGATCTTCTTCTGGTTCGTCA | p.Tyr98ArgfsTer9 | frameshift | Exon 2 of 16 | ENSP00000384199.1 | E9PHA6 | |
| MSH2 | ENST00000918107.1 | c.269_290dupAAGATCTTCTTCTGGTTCGTCA | p.Tyr98ArgfsTer9 | frameshift | Exon 2 of 17 | ENSP00000588166.1 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at