NM_000251.3:c.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000251.3(MSH2):​c.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC​(p.Thr321LeufsTer21) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

MSH2
NM_000251.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 4.97
Variant links:
Genes affected
MSH2 (HGNC:7325): (mutS homolog 2) This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 2-47416311-ACCACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAAC-A is Pathogenic according to our data. Variant chr2-47416311-ACCACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAAC-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 439197.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MSH2NM_000251.3 linkc.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC p.Thr321LeufsTer21 frameshift_variant Exon 6 of 16 ENST00000233146.7 NP_000242.1 P43246-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MSH2ENST00000233146.7 linkc.961_1006delACTGGCTCTCAGTCTCTGGCTGCCTTGCTGAATAAGTGTAAAACCC p.Thr321LeufsTer21 frameshift_variant Exon 6 of 16 1 NM_000251.3 ENSP00000233146.2 P43246-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

not provided Pathogenic:1
May 05, 2017
Quest Diagnostics Nichols Institute San Juan Capistrano
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Nov 14, 2018
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in MSH2 are known to be pathogenic (PMID: 15849733, 24362816). This variant has not been reported in the literature in individuals with MSH2-related disease. ClinVar contains an entry for this variant (Variation ID: 439197). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Thr321Leufs*21) in the MSH2 gene. It is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553353114; hg19: chr2-47643450; API