NM_000256.3:c.541_560delGCCAGCCTCCTGAAGCCGCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000256.3(MYBPC3):​c.541_560delGCCAGCCTCCTGAAGCCGCC​(p.Ala181CysfsTer53) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

MYBPC3
NM_000256.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.99
Variant links:
Genes affected
MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is Pathogenic according to our data. Variant chr11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 42770.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYBPC3NM_000256.3 linkc.541_560delGCCAGCCTCCTGAAGCCGCC p.Ala181CysfsTer53 frameshift_variant Exon 5 of 35 ENST00000545968.6 NP_000247.2 Q14896-1A5YM48

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYBPC3ENST00000545968.6 linkc.541_560delGCCAGCCTCCTGAAGCCGCC p.Ala181CysfsTer53 frameshift_variant Exon 5 of 35 5 NM_000256.3 ENSP00000442795.1 Q14896-1
MYBPC3ENST00000399249.6 linkc.541_560delGCCAGCCTCCTGAAGCCGCC p.Ala181CysfsTer53 frameshift_variant Exon 5 of 34 5 ENSP00000382193.2 A8MXZ9
MYBPC3ENST00000544791.1 linkn.541_560delGCCAGCCTCCTGAAGCCGCC non_coding_transcript_exon_variant Exon 5 of 27 5 ENSP00000444259.1 F5GZR4

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hypertrophic cardiomyopathy Pathogenic:1
Nov 30, 2010
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The Ala181fs has not been reported in the literature. However, this variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 181 and leads to a premature stop codon 53 amino acids downst ream. This alteration is then predicted to lead to a truncated or absent protei n. Loss of function is an established mechanism of disease for the MYBPC3 gene, which makes it highly likely that the Ala181fs variant is pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs397516058; hg19: chr11-47371418; API