NM_000256.3:c.541_560delGCCAGCCTCCTGAAGCCGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_000256.3(MYBPC3):​c.541_560delGCCAGCCTCCTGAAGCCGCC​(p.Ala181CysfsTer53) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

MYBPC3
NM_000256.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.99

Publications

3 publications found
Variant links:
Genes affected
MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]
MYBPC3 Gene-Disease associations (from GenCC):
  • hypertrophic cardiomyopathy
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • hypertrophic cardiomyopathy 4
    Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
  • left ventricular noncompaction 10
    Inheritance: AR, AD Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
  • familial isolated dilated cardiomyopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • arrhythmogenic right ventricular cardiomyopathy
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen
  • atrial fibrillation
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
  • dilated cardiomyopathy
    Inheritance: AD Classification: LIMITED Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is Pathogenic according to our data. Variant chr11-47349867-AGGCGGCTTCAGGAGGCTGGC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 42770.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYBPC3NM_000256.3 linkc.541_560delGCCAGCCTCCTGAAGCCGCC p.Ala181CysfsTer53 frameshift_variant Exon 5 of 35 ENST00000545968.6 NP_000247.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYBPC3ENST00000545968.6 linkc.541_560delGCCAGCCTCCTGAAGCCGCC p.Ala181CysfsTer53 frameshift_variant Exon 5 of 35 5 NM_000256.3 ENSP00000442795.1
MYBPC3ENST00000399249.6 linkc.541_560delGCCAGCCTCCTGAAGCCGCC p.Ala181CysfsTer53 frameshift_variant Exon 5 of 34 5 ENSP00000382193.2
MYBPC3ENST00000544791.1 linkn.541_560delGCCAGCCTCCTGAAGCCGCC non_coding_transcript_exon_variant Exon 5 of 27 5 ENSP00000444259.1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hypertrophic cardiomyopathy Pathogenic:1
Nov 30, 2010
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The Ala181fs has not been reported in the literature. However, this variant is predicted to cause a frameshift, which alters the protein's amino acid sequence beginning at codon 181 and leads to a premature stop codon 53 amino acids downst ream. This alteration is then predicted to lead to a truncated or absent protei n. Loss of function is an established mechanism of disease for the MYBPC3 gene, which makes it highly likely that the Ala181fs variant is pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
10
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397516058; hg19: chr11-47371418; API