NM_000311.5:c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_000311.5(PRNP):c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC(p.His61_Pro76del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000132 in 151,572 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000311.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PRNP | NM_000311.5 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | ENST00000379440.9 | NP_000302.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PRNP | ENST00000379440.9 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | 1 | NM_000311.5 | ENSP00000368752.4 | ||
PRNP | ENST00000424424.2 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | 1 | ENSP00000411599.2 | |||
PRNP | ENST00000430350.2 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | 1 | ENSP00000399376.2 | |||
PRNP | ENST00000457586.2 | c.180_227delTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCC | p.His61_Pro76del | disruptive_inframe_deletion | Exon 2 of 2 | 1 | ENSP00000415284.2 |
Frequencies
GnomAD3 genomes AF: 0.0000132 AC: 2AN: 151572Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000121 AC: 3AN: 248054Hom.: 0 AF XY: 0.0000222 AC XY: 3AN XY: 134918
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000171 AC: 25AN: 1461484Hom.: 0 AF XY: 0.0000124 AC XY: 9AN XY: 727070
GnomAD4 genome AF: 0.0000132 AC: 2AN: 151572Hom.: 0 Cov.: 32 AF XY: 0.0000270 AC XY: 2AN XY: 74020
ClinVar
Submissions by phenotype
Huntington disease-like 1 Uncertain:1
This variant, c.180_227del, results in the deletion of 16 amino acid(s) of the PRNP protein (p.Pro76_Gln91del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the affected amino acid(s) is currently unknown. This variant has not been reported in the literature in individuals with PRNP-related conditions. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at