NM_000368.5:c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000368.5(TSC1):c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG(p.Ser561ArgfsTer19) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G560G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000368.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Genomics England PanelApp
- lung lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000368.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC1 | MANE Select | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift | Exon 15 of 23 | NP_000359.1 | Q92574-1 | ||
| TSC1 | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift | Exon 15 of 23 | NP_001393521.1 | X5D9D2 | |||
| TSC1 | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift | Exon 15 of 23 | NP_001393522.1 | Q92574-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TSC1 | TSL:1 MANE Select | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift | Exon 15 of 23 | ENSP00000298552.3 | Q92574-1 | ||
| TSC1 | TSL:3 | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift | Exon 16 of 24 | ENSP00000495533.2 | Q92574-1 | ||
| TSC1 | c.1680_1702delCAGTGCTGATGAAAGCCCTGCGG | p.Ser561ArgfsTer19 | frameshift | Exon 15 of 23 | ENSP00000495158.1 | Q92574-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at