NM_000368.5:c.2341_2360dupCAGCTGCAGCATGACCGAGA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_000368.5(TSC1):​c.2341_2360dupCAGCTGCAGCATGACCGAGA​(p.Glu787AspfsTer27) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. E787E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

TSC1
NM_000368.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 5.83

Publications

0 publications found
Variant links:
Genes affected
TSC1 (HGNC:12362): (TSC complex subunit 1) This gene is a tumor suppressor gene that encodes the growth inhibitory protein hamartin. The encoded protein interacts with and stabilizes the GTPase activating protein tuberin. This hamartin-tuberin complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. This protein also functions as a co-chaperone for Hsp90 that inhibits its ATPase activity. This protein functions as a facilitator of Hsp90-mediated folding of kinase and non-kinase clients, including TSC2 and thereby preventing their ubiquitination and proteasomal degradation. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
TSC1 Gene-Disease associations (from GenCC):
  • tuberous sclerosis
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • tuberous sclerosis 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
  • lung lymphangioleiomyomatosis
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • tuberous sclerosis complex
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 9-132902635-C-CTCTCGGTCATGCTGCAGCTG is Pathogenic according to our data. Variant chr9-132902635-C-CTCTCGGTCATGCTGCAGCTG is described in ClinVar as Pathogenic. ClinVar VariationId is 411223.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TSC1NM_000368.5 linkc.2341_2360dupCAGCTGCAGCATGACCGAGA p.Glu787AspfsTer27 frameshift_variant Exon 18 of 23 ENST00000298552.9 NP_000359.1 Q92574-1Q86WV8X5D9D2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TSC1ENST00000298552.9 linkc.2341_2360dupCAGCTGCAGCATGACCGAGA p.Glu787AspfsTer27 frameshift_variant Exon 18 of 23 1 NM_000368.5 ENSP00000298552.3 Q92574-1
TSC1ENST00000490179.4 linkc.2341_2360dupCAGCTGCAGCATGACCGAGA p.Glu787AspfsTer27 frameshift_variant Exon 19 of 24 3 ENSP00000495533.2 A0A2R8Y6S8

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Tuberous sclerosis 1 Pathogenic:1
Jul 31, 2016
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change inserts 20 nucleotides in exon 18 of the TSC1 mRNA (c.2341_2360dup20), causing a frameshift at codon 787. This creates a premature translational stop signal (p.Glu787Aspfs*27) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in TSC1 are known to be pathogenic (PMID: 10227394, 17304050). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
5.8
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554814935; hg19: chr9-135778022; API