NM_000383.4:c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1PS1_ModeratePM2PP5_Moderate
The NM_000383.4(AIRE):c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_000383.4 frameshift, start_lost
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 14 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
AIRE | NM_000383.4 | c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 14 | ENST00000291582.6 | NP_000374.1 | |
AIRE | NM_000383.4 | c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG | 5_prime_UTR_variant | Exon 1 of 14 | ENST00000291582.6 | NP_000374.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
AIRE | ENST00000291582.6 | c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG | p.Met1fs | frameshift_variant, start_lost | Exon 1 of 14 | 1 | NM_000383.4 | ENSP00000291582.5 | ||
AIRE | ENST00000291582 | c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG | 5_prime_UTR_variant | Exon 1 of 14 | 1 | NM_000383.4 | ENSP00000291582.5 | |||
AIRE | ENST00000527919.5 | n.145_188delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG | non_coding_transcript_exon_variant | Exon 1 of 14 | 2 | |||||
AIRE | ENST00000530812.5 | n.153_196delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG | non_coding_transcript_exon_variant | Exon 1 of 12 | 2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Polyglandular autoimmune syndrome, type 1 Pathogenic:1
The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This sequence change affects the initiator methionine of the AIRE mRNA. The next in-frame methionine is located at codon 184. Disruption of the initiator codon has been observed in several individuals affected with autoimmune polyendocrinopathy syndrome (PMID: 28911151, 20407228, 19758376, 28446514). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at