NM_000431.4:c.373_527+1del

Variant names:

• chr12-109581391-TCAGGGCCCTGCCGAGCCTGGATATCGTAGTGTGGTCGGAGCTGCCCCCCGGGGCGGGCTTGGGCTCCAGCGCCGCCTACTCGGTGTGTCTGGCAGCAGCCCTCCTGACTGTGTGCGAGGAGATCCCAAACCCGCTGAAGGACGGGGATTGCGTCAA-T
• rs104895310
• NM_000431.4:c.373_527+1del

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000431.4(MVK):​c.373_527+1del​(p.Ala125fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MVK NM_000431.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.95
• Publications: 0 publications found

Genes affected

MVK (HGNC:7530): (mevalonate kinase) This gene encodes the peroxisomal enzyme mevalonate kinase. Mevalonate is a key intermediate, and mevalonate kinase a key early enzyme, in isoprenoid and sterol synthesis. Mevalonate kinase deficiency caused by mutation of this gene results in mevalonic aciduria, a disease characterized psychomotor retardation, failure to thrive, hepatosplenomegaly, anemia and recurrent febrile crises. Defects in this gene also cause hyperimmunoglobulinaemia D and periodic fever syndrome, a disorder characterized by recurrent episodes of fever associated with lymphadenopathy, arthralgia, gastrointestinal dismay and skin rash. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

MVK Gene-Disease associations (from GenCC):

• porokeratosis 3, disseminated superficial actinic type

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• hyperimmunoglobulinemia D with periodic fever

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• mevalonic aciduria

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• disseminated superficial actinic porokeratosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• porokeratosis of Mibelli

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000431.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MVK	NM_000431.4	MANE Select	c.373_527+1del	p.Ala125fs	frameshift splice_donor splice_region intron	Exon 5 of 11	NP_000422.1
	MVK	NM_001414515.1		c.-210_-56+1del		splice_region	Exon 4 of 10	NP_001401444.1
	MVK	NM_001414512.1		c.373_527+1del	p.Ala125fs	frameshift splice_donor splice_region intron	Exon 5 of 12	NP_001401441.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MVK	ENST00000228510.8	TSL:1 MANE Select	c.372-3_524del	p.Arg124_Asn175delinsSer	splice_acceptor disruptive_inframe_deletion splice_region intron	Exon 5 of 11	ENSP00000228510.3
	MVK	ENST00000537237.5	TSL:5	n.*136-3_*288del		splice_region non_coding_transcript_exon	Exon 6 of 11	ENSP00000445382.1
	MVK	ENST00000545516.1	TSL:3	n.-87_69del		non_coding_transcript_exon	Exon 1 of 3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs104895310; hg19: chr12-110019196;