NM_000465.4:c.1935_1954delTGAACAGGAAGAAAAGTATG

Variant names:

• chr2-214730457-TCATACTTTTCTTCCTGTTCA-T
• rs587780024
• NM_000465.4:c.1935_1954delTGAACAGGAAGAAAAGTATG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000465.4(BARD1):​c.1935_1954delTGAACAGGAAGAAAAGTATG​(p.Cys645fs) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000684 in 1,461,736 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. C645C) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: BARD1 NM_000465.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 6.51
• Publications: 19 publications found

Genes affected

BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

BARD1 Gene-Disease associations (from GenCC):

• breast cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
• familial ovarian cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 80 pathogenic variants in the truncated region.
• PP5: Variant 2-214730457-TCATACTTTTCTTCCTGTTCA-T is Pathogenic according to our data. Variant chr2-214730457-TCATACTTTTCTTCCTGTTCA-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 265510.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BARD1	NM_000465.4	c.1935_1954delTGAACAGGAAGAAAAGTATG	p.Cys645fs	frameshift_variant	Exon 10 of 11	ENST00000260947.9	NP_000456.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BARD1	ENST00000260947.9	c.1935_1954delTGAACAGGAAGAAAAGTATG	p.Cys645fs	frameshift_variant	Exon 10 of 11	1	NM_000465.4	ENSP00000260947.4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461736 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727158

African (AFR) AF: 0.00 AC: 0 AN: 33472

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26126

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39662

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53398

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111950

Other (OTH) AF: 0.00 AC: 0 AN: 60386

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial cancer of breast Pathogenic:3

Aug 13, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Cys645*) in the BARD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with BARD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 265510). For these reasons, this variant has been classified as Pathogenic. -

May 25, 2023

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a termination codon and is predicted to result in premature protein truncation. -

Oct 11, 2022

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

Dec 03, 2015

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This deletion of 20 nucleotides is denoted BARD1 c.1935_1954del20 at the cDNA level and p.Cys645Ter (C645X) at the protein level. The normal sequence, with the bases that are deleted in braces, is TATG[del20]AAAT. The deletion creates a nonsense variant, which changes a Cysteine to a premature stop codon. This variant has not been previously reported in the literature to our knowledge. BARD1 c.1935_1954del20 results in the loss of 133 amino acids at the end of the protein, which might affect normal function. This variant occurs in the BRCT1 and BRCT2 domains, which may be disrupted by this deletion (UniProt). However, due to the location of the newly created nonsense codon, the transcript is not expected to undergo nonsense-mediated decay and could therefore encode a truncated protein that retains some normal function. BARD1 c.1935_1954del20 was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. Based on currently available information, we consider BARD1 c.1935_1954del20 to be a likely pathogenic variant. -

Gastric cancer Pathogenic:1

Jul 01, 2021

Laboratory for Genotyping Development, RIKEN

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587780024; hg19: chr2-215595181;