NM_000474.4:c.395_415delGGAAGATCATCCCCACGCTGC
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_000474.4(TWIST1):c.395_415delGGAAGATCATCCCCACGCTGC(p.Arg132_Leu138del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000474.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Saethre-Chotzen syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, G2P, PanelApp Australia, Laboratory for Molecular Medicine, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
- TWIST1-related craniosynostosisInheritance: AD Classification: STRONG, MODERATE Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp
- isolated brachycephalyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- isolated plagiocephalyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- isolated scaphocephalyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Sweeney-Cox syndromeInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000474.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TWIST1 | NM_000474.4 | MANE Select | c.395_415delGGAAGATCATCCCCACGCTGC | p.Arg132_Leu138del | disruptive_inframe_deletion | Exon 1 of 2 | NP_000465.1 | ||
| TWIST1 | NR_149001.2 | n.710_730delGGAAGATCATCCCCACGCTGC | non_coding_transcript_exon | Exon 1 of 3 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TWIST1 | ENST00000242261.6 | TSL:1 MANE Select | c.395_415delGGAAGATCATCCCCACGCTGC | p.Arg132_Leu138del | disruptive_inframe_deletion | Exon 1 of 2 | ENSP00000242261.5 | ||
| TWIST1 | ENST00000443687.5 | TSL:4 | n.-5_16delGGAAGATCATCCCCACGCTGC | 5_prime_UTR_truncation exon_loss | Exon 1 of 4 | ENSP00000416986.1 | |||
| TWIST1 | ENST00000354571.5 | TSL:2 | n.191_211delGGAAGATCATCCCCACGCTGC | non_coding_transcript_exon | Exon 1 of 3 | ENSP00000346582.5 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Saethre-Chotzen syndrome;C4551902:TWIST1-related craniosynostosis Uncertain:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at