NM_000492.4:c.2998_3019delATTGTGATTGGAGCTATAGCAG

Variant names:

• chr7-117610527-AATTGTGATTGGAGCTATAGCAG-A
• rs397508474
• NM_000492.4:c.2998_3019delATTGTGATTGGAGCTATAGCAG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000492.4(CFTR):​c.2998_3019delATTGTGATTGGAGCTATAGCAG​(p.Ile1000LeufsTer16) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars). Synonymous variant affecting the same amino acid position (i.e. I1000I) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: CFTR NM_000492.4 frameshift
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 9.54
• Publications: 0 publications found

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR Gene-Disease associations (from GenCC):

• cystic fibrosis

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Myriad Women’s Health, Orphanet
• congenital bilateral absence of vas deferens

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary chronic pancreatitis

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000083622 (HGNC:40145):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CFTR	NM_000492.4	c.2998_3019delATTGTGATTGGAGCTATAGCAG	p.Ile1000LeufsTer16	frameshift_variant	Exon 19 of 27	ENST00000003084.11	NP_000483.3
CFTR-AS2	NR_199597.1	n.178-5560_178-5539delCTGCTATAGCTCCAATCACAAT		intron_variant	Intron 2 of 2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CFTR	ENST00000003084.11	c.2998_3019delATTGTGATTGGAGCTATAGCAG	p.Ile1000LeufsTer16	frameshift_variant	Exon 19 of 27	1	NM_000492.4	ENSP00000003084.6

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Cystic fibrosis Other:1

-

ClinVar Staff, National Center for Biotechnology Information (NCBI)

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397508474; hg19: chr7-117250581;