NM_000492.4:c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PM1PM2PM4PP5_Very_Strong

The NM_000492.4(CFTR):​c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA​(p.Val1022_Gln1039del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★).

Frequency

Genomes: not found (cov: 31)

Consequence

CFTR
NM_000492.4 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3O:1

Conservation

PhyloP100: 5.95
Variant links:
Genes affected
CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 14 ACMG points.

PM1
In a domain ABC transmembrane type-1 2 (size 296) in uniprot entity CFTR_HUMAN there are 53 pathogenic changes around while only 8 benign (87%) in NM_000492.4
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_000492.4.
PP5
Variant 7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C is Pathogenic according to our data. Variant chr7-117610592-CAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCA-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 53645.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CFTRNM_000492.4 linkc.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA p.Val1022_Gln1039del conservative_inframe_deletion Exon 19 of 27 ENST00000003084.11 NP_000483.3 P13569-1A0A024R730

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CFTRENST00000003084.11 linkc.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA p.Val1022_Gln1039del conservative_inframe_deletion Exon 19 of 27 1 NM_000492.4 ENSP00000003084.6 P13569-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:3Other:1
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Cystic fibrosis Pathogenic:3Other:1
Jan 29, 2018
CFTR-France
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: curation

- -

Sep 21, 2023
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.3064_3117del, results in the deletion of 18 amino acid(s) of the CFTR protein (p.Val1022_Gln1039del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with cystic fibrosis (PMID: 8880589). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 53645). This variant disrupts a region of the CFTR protein in which other variant(s) (p.Ile1023_Val1024del) have been determined to be pathogenic (PMID: 7516234, 12394343, 15287992, 22020151, 22627569). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Jul 01, 2023
Division of Human Genetics, National Health Laboratory Service/University of the Witwatersrand
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: research

- -

-
ClinVar Staff, National Center for Biotechnology Information (NCBI)
Significance: not provided
Review Status: no classification provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554392027; hg19: chr7-117250646; API