NM_000518.5:c.93-30_96delCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA
Variant summary
Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PVS1_StrongPM2PP5
The NM_000518.5(HBB):c.93-30_96delCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA(p.Arg31_Leu32delinsSer???) variant causes a splice acceptor, splice region, synonymous, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. R31R) has been classified as Likely pathogenic.
Frequency
Consequence
NM_000518.5 splice_acceptor, splice_region, synonymous, intron
Scores
Clinical Significance
Conservation
Publications
- dominant beta-thalassemiaInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
- hemoglobin M diseaseInheritance: AD Classification: DEFINITIVE, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen
- beta thalassemiaInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- beta-thalassemia HBB/LCRBInheritance: AR, SD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- sickle cell disease and related diseasesInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- erythrocytosis, familial, 6Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- Heinz body anemiaInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- sickle cell diseaseInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
- hereditary persistence of fetal hemoglobin-beta-thalassemia syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- beta-thalassemia intermediaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- beta-thalassemia majorInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- delta-beta-thalassemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hemoglobin C diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hemoglobin C-beta-thalassemia syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hemoglobin E diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hemoglobin E-beta-thalassemia syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary persistence of fetal hemoglobin-sickle cell disease syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- sickle cell-beta-thalassemia disease syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- sickle cell-hemoglobin c disease syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- sickle cell-hemoglobin d disease syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- sickle cell-hemoglobin E disease syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 7 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| HBB | NM_000518.5 | c.93-30_96delCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA | p.Arg31_Leu32delinsSer??? | splice_acceptor_variant, splice_region_variant, synonymous_variant, intron_variant | ENST00000335295.4 | NP_000509.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| HBB | ENST00000335295.4 | c.93-30_96delCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA | p.Arg31_Leu32delinsSer??? | splice_acceptor_variant, splice_region_variant, synonymous_variant, intron_variant | 1 | NM_000518.5 | ENSP00000333994.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not specified Uncertain:2
- -
Variant summary: The variant HBB c.93-30_96delins32 (i.e. c.93-30_96delinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA) involves the deletion of 30 intronic nucleotides in intron 1 and the first 4 exonic nucleotides in exon 2 and the subsequent insertion of 32 nucleotides. The inserted nucleotide sequence in this variant is predicted to replace the first 4 nucleotides of exon 2 (GCTG) by a different set of nucleotides (ATTA) leading to an in-frame modification at the protein level. Although all 5 in-silico splice analysis tools predict a minor effect on splicing (i.e. prediction of a new splice acceptor site at the same position as in the reference sequence), the region between c.93-21_93-3 is highly sensitive to point mutations. Other reported variants, such as c.93-21G>A, c.93-15T>G and c.93-3T>G as well as multiple deletion/insertion in this region are considered pathogenic in association with beta-thalassemia. In addition, the possibility of a gene conversion from HBD to HBB limited to this 32 base pair insertion versus a gene fusion between HbD and HbB resulting in Hb-Lepore or another variant hemoglobin cannot be entirely ruled out. The variant was absent from controls in gnomAD (246058 control chromosomes). Thus the available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.93-30_96delins32 in individuals affected with Beta Thalassemia and no experimental evidence demonstrating its impact on protein function have been reported. It has however, been observed in at least 4 patients tested at our laboratory, 3 of whom were carriers of this variant without a second disease causing variant. However, one of these 4 individuals was reportedly affected with a mild-anemia, and is compound heterozygous for this variant and another pathogenic variant in the promoter region of the HBB gene. A ClinVar submission from another clinical diagnostic laboratory (evaluation after 2014) cites the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as uncertain significance. -
not provided Pathogenic:1
This variant results in the deletion of part of exon 2 (c.93-30_96delins32) of the HBB gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in HBB are known to be pathogenic (PMID: 23637309). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with HBB-related conditions. ClinVar contains an entry for this variant (Variation ID: 439168). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at