NM_000527.5:c.651_687delTGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGAA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_000527.5(LDLR):​c.651_687delTGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGAA​(p.Asp217GlufsTer36) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. D217D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

LDLR
NM_000527.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 9.21

Publications

1 publications found
Variant links:
Genes affected
LDLR (HGNC:6547): (low density lipoprotein receptor) The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. The encoded protein is normally bound at the cell membrane, where it binds low density lipoprotein/cholesterol and is taken into the cell. Lysosomes release the cholesterol, which is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2022]
LDLR Gene-Disease associations (from GenCC):
  • hypercholesterolemia, familial, 1
    Inheritance: AD, SD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, ClinGen
  • homozygous familial hypercholesterolemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 19-11105555-GATGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGA-G is Pathogenic according to our data. Variant chr19-11105555-GATGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 251351.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
LDLRNM_000527.5 linkc.651_687delTGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGAA p.Asp217GlufsTer36 frameshift_variant Exon 4 of 18 ENST00000558518.6 NP_000518.1 P01130-1A0A024R7D5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
LDLRENST00000558518.6 linkc.651_687delTGGTGGCCCCGACTGCAAGGACAAATCTGACGAGGAA p.Asp217GlufsTer36 frameshift_variant Exon 4 of 18 1 NM_000527.5 ENSP00000454071.1 P01130-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Hypercholesterolemia, familial, 1 Pathogenic:1
Mar 25, 2016
LDLR-LOVD, British Heart Foundation
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:literature only

- -

Familial hypercholesterolemia Pathogenic:1
Oct 07, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 251351). This variant is also known as del 37 in codon 196-208. This premature translational stop signal has been observed in individual(s) with familial hypercholesterolemia (PMID: 7649546). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Asp217Glufs*36) in the LDLR gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in LDLR are known to be pathogenic (PMID: 20809525, 28645073). -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.2
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs879254615; hg19: chr19-11216231; API