NM_000540.3:c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000540.3(RYR1):c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000540.3 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- RYR1-related myopathyInheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| RYR1 | NM_000540.3 | c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC | splice_region_variant, intron_variant | Intron 48 of 105 | ENST00000359596.8 | NP_000531.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| RYR1 | ENST00000359596.8 | c.7835+6_7835+36delGCGGGGCAGGCTTCAGGGTGGGGCAGGGGCAinsAGC | splice_region_variant, intron_variant | Intron 48 of 105 | 5 | NM_000540.3 | ENSP00000352608.2 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD4 genome Cov.: 17
ClinVar
Submissions by phenotype
RYR1-related disorder Uncertain:1
This sequence change falls in intron 48 of the RYR1 gene. It does not directly change the encoded amino acid sequence of the RYR1 protein, but it affects a nucleotide within the consensus splice site of the intron. This variant is present in population databases (rs768070268, ExAC 0.001335%). This variant has not been reported in the literature in individuals with RYR1-related disease. Nucleotide substitutions within the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant is not likely to affect RNA splicing, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at