NM_000548.5:c.2429_2461delTCTGCAGCGTGGAGATGCCTGACATCATCATCAinsC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_000548.5(TSC2):​c.2429_2461delTCTGCAGCGTGGAGATGCCTGACATCATCATCAinsC​(p.Ile810ThrfsTer62) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. I810I) has been classified as Uncertain significance. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

TSC2
NM_000548.5 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.92

Publications

0 publications found
Variant links:
Genes affected
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
TSC2 Gene-Disease associations (from GenCC):
  • tuberous sclerosis
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • tuberous sclerosis 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
  • lymphangioleiomyomatosis
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • tuberous sclerosis complex
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 16-2074273-TCTGCAGCGTGGAGATGCCTGACATCATCATCA-C is Pathogenic according to our data. Variant chr16-2074273-TCTGCAGCGTGGAGATGCCTGACATCATCATCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 237989.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TSC2NM_000548.5 linkc.2429_2461delTCTGCAGCGTGGAGATGCCTGACATCATCATCAinsC p.Ile810ThrfsTer62 frameshift_variant, missense_variant Exon 22 of 42 ENST00000219476.9 NP_000539.2 P49815-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TSC2ENST00000219476.9 linkc.2429_2461delTCTGCAGCGTGGAGATGCCTGACATCATCATCAinsC p.Ile810ThrfsTer62 frameshift_variant, missense_variant Exon 22 of 42 5 NM_000548.5 ENSP00000219476.3 P49815-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Tuberous sclerosis 2 Pathogenic:1
Jan 29, 2016
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change deletes 33 nucleotides and inserts 1 nucleotide in exon 22 of the TSC2 mRNA (c.2429_2461delinsC), causing a frameshift at codon 810. This creates a premature translational stop signal (p.Ile810Lysfs*62) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in TSC2 are known to be pathogenic (PMID: 10205261, 17304050). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs878854082; hg19: chr16-2124274; API