NM_000551.4:c.-78_-58delGCGCGCACGCAGCTCCGCCCC

Variant names:

• chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A
• rs727503744
• NM_000551.4:c.-78_-58delGCGCGCACGCAGCTCCGCCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PP5_Very_Strong

The NM_000551.4(VHL):​c.-78_-58delGCGCGCACGCAGCTCCGCCCC variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: VHL NM_000551.4 5_prime_UTR
• Clinical Significance: Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 3.83
• Publications: 1 publications found

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL Gene-Disease associations (from GenCC):

• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• von Hippel-Lindau disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp, G2P
• renal cell carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• autosomal recessive secondary polycythemia not associated with VHL gene

  Inheritance: AR Classification: STRONG Submitted by: Ambry Genetics
• Chuvash polycythemia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PP5: Variant 3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is Pathogenic according to our data. Variant chr3-10141769-AGCGCGCACGCAGCTCCGCCCC-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 166561.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000551.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	NM_000551.4	MANE Select	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR	Exon 1 of 3	NP_000542.1	A0A024R2F2
	VHL	NM_000551.4	MANE Select	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		non_coding_transcript	N/A	NP_000542.1	A0A024R2F2
	VHL	NM_001354723.2		c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR	Exon 1 of 3	NP_001341652.1	A0A8Q3WL21

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	ENST00000256474.3	TSL:1 MANE Select	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR	Exon 1 of 3	ENSP00000256474.3	P40337-1
	VHL	ENST00000345392.3	TSL:1	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		5_prime_UTR	Exon 1 of 2	ENSP00000344757.2	P40337-2
	VHL	ENST00000256474.3	TSL:1 MANE Select	c.-78_-58delGCGCGCACGCAGCTCCGCCCC		non_coding_transcript	N/A	ENSP00000256474.3	P40337-1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Von Hippel-Lindau syndrome (2)
1	-	-	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727503744; hg19: chr3-10183453;