NM_001009944.3:c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_001009944.3(PKD1):​c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT​(p.Asp309GlyfsTer55) variant causes a frameshift, missense change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

PKD1
NM_001009944.3 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 2.33

Publications

0 publications found
Variant links:
Genes affected
PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PKD1 Gene-Disease associations (from GenCC):
  • autosomal dominant polycystic kidney disease
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • polycystic kidney disease 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
  • autosomal recessive polycystic kidney disease
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • Caroli disease
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 16-2118044-GGCATCCACCTCGGCGGAGCCGTCT-ATCCA is Pathogenic according to our data. Variant chr16-2118044-GGCATCCACCTCGGCGGAGCCGTCT-ATCCA is described in ClinVar as [Pathogenic]. Clinvar id is 448026.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PKD1NM_001009944.3 linkc.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT p.Asp309GlyfsTer55 frameshift_variant, missense_variant Exon 5 of 46 ENST00000262304.9 NP_001009944.3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PKD1ENST00000262304.9 linkc.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT p.Asp309GlyfsTer55 frameshift_variant, missense_variant Exon 5 of 46 1 NM_001009944.3 ENSP00000262304.4 P98161-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Jun 07, 2017
Athena Diagnostics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555459056; hg19: chr16-2168045; API