NM_001009944.3:c.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1PM2PM4PP5

The NM_001009944.3(PKD1):​c.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG​(p.Ala3225_Glu3233del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

PKD1
NM_001009944.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1U:1

Conservation

PhyloP100: 7.41
Variant links:
Genes affected
PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

PM1
In a domain PLAT (size 115) in uniprot entity PKD1_HUMAN there are 30 pathogenic changes around while only 9 benign (77%) in NM_001009944.3
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_001009944.3.
PP5
Variant 16-2100177-ACCTCCTTCTCCACCAGGCCCCCGTTGG-A is Pathogenic according to our data. Variant chr16-2100177-ACCTCCTTCTCCACCAGGCCCCCGTTGG-A is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 448028.We mark this variant Likely_pathogenic, oryginal submissions are: {Likely_pathogenic=1, Uncertain_significance=1}. Variant chr16-2100177-ACCTCCTTCTCCACCAGGCCCCCGTTGG-A is described in Lovd as [Pathogenic]. Variant chr16-2100177-ACCTCCTTCTCCACCAGGCCCCCGTTGG-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PKD1NM_001009944.3 linkc.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG p.Ala3225_Glu3233del disruptive_inframe_deletion Exon 28 of 46 ENST00000262304.9 NP_001009944.3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PKD1ENST00000262304.9 linkc.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG p.Ala3225_Glu3233del disruptive_inframe_deletion Exon 28 of 46 1 NM_001009944.3 ENSP00000262304.4 P98161-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Conflicting classifications of pathogenicity
Submissions summary: Pathogenic:1Uncertain:1
Revision: criteria provided, conflicting classifications
LINK: link

Submissions by phenotype

Polycystic kidney disease, adult type Pathogenic:1
Apr 16, 2024
Fulgent Genetics, Fulgent Genetics
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

not specified Uncertain:1
Apr 14, 2017
Athena Diagnostics
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555449461; hg19: chr16-2150178; API