NM_001039958.2:c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG
Variant summary
Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_StrongBS1BS2
The NM_001039958.2(MESP2):c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG(p.Gln184_Gly195del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. G183G) has been classified as Likely benign.
Frequency
Consequence
NM_001039958.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- spondylocostal dysostosis 2, autosomal recessiveInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- autosomal recessive spondylocostal dysostosisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MESP2 | NM_001039958.2 | c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG | p.Gln184_Gly195del | disruptive_inframe_deletion | Exon 1 of 2 | ENST00000341735.5 | NP_001035047.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MESP2 | ENST00000341735.5 | c.549_584delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG | p.Gln184_Gly195del | disruptive_inframe_deletion | Exon 1 of 2 | 1 | NM_001039958.2 | ENSP00000342392.3 | ||
| MESP2 | ENST00000560219.2 | c.31-1159_31-1124delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG | intron_variant | Intron 2 of 2 | 1 | ENSP00000452998.1 | ||||
| MESP2 | ENST00000558723.1 | n.39-1159_39-1124delGCAGGGGCAGGGGCAGGGGCAAGGGCAGGGGCAAGG | intron_variant | Intron 1 of 1 | 3 |
Frequencies
GnomAD3 genomes AF: 0.00895 AC: 534AN: 59648Hom.: 2 Cov.: 0 show subpopulations
GnomAD2 exomes AF: 0.00430 AC: 305AN: 70850 AF XY: 0.00470 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0189 AC: 8142AN: 431272Hom.: 29 AF XY: 0.0181 AC XY: 3814AN XY: 211190 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00894 AC: 534AN: 59704Hom.: 2 Cov.: 0 AF XY: 0.00796 AC XY: 226AN XY: 28394 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:2
- -
MESP2: BS1, BS2 -
not specified Benign:1
- -
Spondylocostal dysostosis 2, autosomal recessive Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at