NM_001042492.3:c.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_001042492.3(NF1):c.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT(p.Val1757fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001042492.3 frameshift, splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
NF1 | NM_001042492.3 | c.5269-41_5291delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT | p.Val1757fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 38 of 58 | ENST00000358273.9 | NP_001035957.1 | |
NF1 | NM_000267.3 | c.5206-41_5228delTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCAAGT | p.Val1736fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 37 of 57 | NP_000258.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
NF1 | ENST00000358273.9 | c.5269-44_5288delAGTTTAATTCTTCTCCACTTCACCCCGTCACCACCACTTTCCAGGTTGGTTCTACTGCTGTCCA | p.Val1757fs | frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant | Exon 38 of 58 | 1 | NM_001042492.3 | ENSP00000351015.4 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Neurofibromatosis, type 1 Pathogenic:1
This sequence change affects an acceptor splice site in intron 36 and removes the first 23 nucleotides of exon 37 of the NF1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in NF1 are known to be pathogenic (PMID: 10712197, 23913538). For these reasons, this variant has been classified as Pathogenic. A single nucleotide change affecting the acceptor splice site, c.5206-1G>A, has been classified as pathogenic (Invitae). In addition, a smaller deletion c.5206-5_5220del has been reported in an individual suspected with NF1 (PMID: 23758643). This suggests that the deleted region is important for normal RNA splicing, and that other variants at this position may also be pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at