NM_001042492.3:c.7076_7102delTATTTATGGCAATCCGGAATCCTCTGG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM4PP3PP5_Moderate

The NM_001042492.3(NF1):​c.7076_7102delTATTTATGGCAATCCGGAATCCTCTGG​(p.Val2359_Leu2367del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V2359V) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

NF1
NM_001042492.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.18

Publications

0 publications found
Variant links:
Genes affected
NF1 (HGNC:7765): (neurofibromin 1) This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
NF1 Gene-Disease associations (from GenCC):
  • neurofibromatosis type 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, G2P, Genomics England PanelApp
  • neurofibromatosis-Noonan syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, PanelApp Australia
  • Moyamoya disease
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary pheochromocytoma-paraganglioma
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • familial ovarian cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_001042492.3.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 17-31343020-AGTATTTATGGCAATCCGGAATCCTCTG-A is Pathogenic according to our data. Variant chr17-31343020-AGTATTTATGGCAATCCGGAATCCTCTG-A is described in ClinVar as [Pathogenic]. Clinvar id is 522586.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NF1NM_001042492.3 linkc.7076_7102delTATTTATGGCAATCCGGAATCCTCTGG p.Val2359_Leu2367del disruptive_inframe_deletion Exon 48 of 58 ENST00000358273.9 NP_001035957.1 P21359-1
NF1NM_000267.4 linkc.7013_7039delTATTTATGGCAATCCGGAATCCTCTGG p.Val2338_Leu2346del disruptive_inframe_deletion Exon 47 of 57 NP_000258.1 P21359-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NF1ENST00000358273.9 linkc.7076_7102delTATTTATGGCAATCCGGAATCCTCTGG p.Val2359_Leu2367del disruptive_inframe_deletion Exon 48 of 58 1 NM_001042492.3 ENSP00000351015.4 P21359-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Neurofibromatosis, type 1 Pathogenic:1
Jul 12, 2017
Fan Lab, Zhengzhou University
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.7013_7039del mutation in NF1 gene, resulting p.Val2338_Leu2346del in the amino acid sequence of NF1 protein, has not been reported in patient with Neurofibromatosis type 1 yet. According to the functional prediction and two-generation pedigree analysis, this mutation was consider to be pathogenic in our case. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.2
Mutation Taster
=4/196
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555535403; hg19: chr17-29670038; API