NM_001100.4:c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC

Variant names:

• chr1-229431916-CGGGGAGCGTGAGCAGAAGCTC-GGGGGGAGCGTGAGCAGAAGCT
• rs1553255366
• NM_001100.4:c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_001100.4(ACTA1):​c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type MNV, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: ACTA1 NM_001100.4 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.611
• Publications: 0 publications found

Genes affected

ACTA1 (HGNC:129): (actin alpha 1, skeletal muscle) The product encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. Mutations in this gene cause a variety of myopathies, including nemaline myopathy, congenital myopathy with excess of thin myofilaments, congenital myopathy with cores, and congenital myopathy with fiber-type disproportion, diseases that lead to muscle fiber defects with manifestations such as hypotonia. [provided by RefSeq, Sep 2019]

ACTA1 Gene-Disease associations (from GenCC):

• alpha-actinopathy

  Inheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
• congenital myopathy 2a, typical, autosomal dominant

  Inheritance: AR, SD, AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• congenital myopathy with excess of thin filaments

  Inheritance: SD Classification: DEFINITIVE Submitted by: Illumina
• congenital myopathy 2c, severe infantile, autosomal dominant

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• childhood-onset nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• congenital fiber-type disproportion myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• intermediate nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• progressive scapulohumeroperoneal distal myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• typical nemaline myopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• rigid spine syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• severe congenital nemaline myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• zebra body myopathy

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000290037 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 1-229431916-CGGGGAGCGTGAGCAGAAGCTC-GGGGGGAGCGTGAGCAGAAGCT is Benign according to our data. Variant chr1-229431916-CGGGGAGCGTGAGCAGAAGCTC-GGGGGGAGCGTGAGCAGAAGCT is described in ClinVar as Benign. ClinVar VariationId is 517171.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ACTA1	NM_001100.4	c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant	Intron 5 of 6	ENST00000366684.7	NP_001091.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ACTA1	ENST00000366684.7	c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant	Intron 5 of 6	1	NM_001100.4	ENSP00000355645.3
ACTA1	ENST00000366683.4	c.809-35_809-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant	Intron 5 of 6	5		ENSP00000355644.4
ACTA1	ENST00000684723.1	c.674-35_674-14delGAGCTTCTGCTCACGCTCCCCGinsAGCTTCTGCTCACGCTCCCCCC		intron_variant	Intron 4 of 5			ENSP00000508084.1
ENSG00000290037	ENST00000702606.2	n.*55_*76delCGGGGAGCGTGAGCAGAAGCTCinsGGGGGGAGCGTGAGCAGAAGCT		downstream_gene_variant

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Dec 13, 2016

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

c.809-35_809-14delins22 in intron 5 of ACTA1: This variant is not expected to ha ve clinical significance because it has been identified (as separate changes) in 15 - 21% of chromosomes from multiple diverse populations by the Genome Aggrega tion Database (gnomAD, http://gnomad.broadinstitute.org/; dbSNP: rs59228224; rs2 01427429; rs398123565) -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.61

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553255366; hg19: chr1-229567663;