NM_001110792.2:c.1097_1192delGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCC
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4
The NM_001110792.2(MECP2):c.1097_1192delGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCC(p.Arg366_Pro397del) variant causes a disruptive inframe deletion change. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001110792.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1097_1192delGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCC | p.Arg366_Pro397del | disruptive_inframe_deletion | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.1061_1156delGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCC | p.Arg354_Pro385del | disruptive_inframe_deletion | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.1097_1192delGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCC | p.Arg366_Pro397del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.1061_1156delGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCACTCAGAGTCCCCAAAGGCCCCCGTGCCACTGCTCCCACCCC | p.Arg354_Pro385del | disruptive_inframe_deletion | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 16
GnomAD4 genome Cov.: 16
ClinVar
Submissions by phenotype
Rett syndrome Uncertain:2
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as a variant of uncertain significance. At least the following criteria are met: This variant is absent from gnomAD (PM2_Supporting). This variant has been identified as a de novo occurrence in an individual with Rett syndrome without confirmation of paternity and maternity (PM6). PMID: 12065946 At least one individual with this variant has been reported with a clinical phenotype consistent with Rett syndrome (PP4).PMID: 12065946 -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at