NM_001110792.2:c.1188_1208delACCCCTGCCCCCACCTCCACC
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4
The NM_001110792.2(MECP2):c.1188_1208delACCCCTGCCCCCACCTCCACC(p.Pro397_Pro403del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P396P) has been classified as Likely benign.
Frequency
Consequence
NM_001110792.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | c.1188_1208delACCCCTGCCCCCACCTCCACC | p.Pro397_Pro403del | disruptive_inframe_deletion | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
| MECP2 | NM_004992.4 | c.1152_1172delACCCCTGCCCCCACCTCCACC | p.Pro385_Pro391del | disruptive_inframe_deletion | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | c.1188_1208delACCCCTGCCCCCACCTCCACC | p.Pro397_Pro403del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | c.1152_1172delACCCCTGCCCCCACCTCCACC | p.Pro385_Pro391del | disruptive_inframe_deletion | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes AF: 0.0000220 AC: 1AN: 45532Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000134 AC: 1AN: 748978Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 224762 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000220 AC: 1AN: 45532Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 10470 show subpopulations
ClinVar
Submissions by phenotype
Severe neonatal-onset encephalopathy with microcephaly Uncertain:1
This variant, c.1152_1172del, results in the deletion of 7 amino acid(s) of the MECP2 protein (p.Pro385_Pro391del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MECP2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
not provided Uncertain:1
In-frame deletion of 7 amino acids in a non-repeat region; Not observed at significant frequency in large population cohorts (gnomAD); In silico analysis supports that this variant does not alter protein structure/function; Has not been previously published as pathogenic or benign to our knowledge -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at