NM_001110792.2:c.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong

The NM_001110792.2(MECP2):​c.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC​(p.Pro397HisfsTer5) variant causes a frameshift change. Variant has been reported in ClinVar as Pathogenic (★★).

Frequency

Genomes: not found (cov: 17)

Consequence

MECP2
NM_001110792.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:5

Conservation

PhyloP100: 5.66
Variant links:
Genes affected
MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.206 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PP5
Variant X-154030632-GGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT-G is Pathogenic according to our data. Variant chrX-154030632-GGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT-G is described in ClinVar as [Pathogenic]. Clinvar id is 143354.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-154030632-GGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT-G is described in Lovd as [Pathogenic]. Variant chrX-154030632-GGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MECP2NM_001110792.2 linkc.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC p.Pro397HisfsTer5 frameshift_variant Exon 3 of 3 ENST00000453960.7 NP_001104262.1 P51608-2A0A140VKC4Q59FJ6
MECP2NM_004992.4 linkc.1152_1195delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC p.Pro385HisfsTer5 frameshift_variant Exon 4 of 4 ENST00000303391.11 NP_004983.1 P51608-1D3YJ43Q59FJ6

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MECP2ENST00000453960.7 linkc.1188_1231delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC p.Pro397HisfsTer5 frameshift_variant Exon 3 of 3 1 NM_001110792.2 ENSP00000395535.2 P51608-2
MECP2ENST00000303391.11 linkc.1152_1195delACCCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACC p.Pro385HisfsTer5 frameshift_variant Exon 4 of 4 1 NM_004992.4 ENSP00000301948.6 P51608-1

Frequencies

GnomAD3 genomes
Cov.:
17
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
17

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:5
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Rett syndrome Pathogenic:4
Apr 12, 2000
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Jan 09, 2024
Centre for Population Genomics, CPG
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: curation

This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). (ClinVar Variation ID:143354, RettBASE, PMID: 10767337, 19914908, 17089071, 29428920, 16473305, 18842453, 16672765, 31645986, 14734626, 15578576, 11738879, 12111643) . This variant has been identified as a de novo occurrence in at least one individual with Rett syndrome without confirmation of paternity and maternity (PM6).(PMID: 17089071, 10767337). This variant is absent from gnomAD (PM2_Supporting). -

Feb 08, 2013
Genetic Services Laboratory, University of Chicago
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Feb 15, 2011
RettBASE
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: curation

- -

Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
Mar 23, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro385Hisfs*5) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 102 amino acid(s) of the MECP2 protein. This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with Rett syndrome (PMID: 11269512, 17089071, 19914908). This variant is also known as 1152del44. ClinVar contains an entry for this variant (Variation ID: 143354). This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Gln406*) have been determined to be pathogenic (PMID: 10986043, 14560307, 22476991). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs267608372; hg19: chrX-153296083; API