NM_001110792.2:c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_001110792.2(MECP2):c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC(p.Leu398AlafsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000371 in 1,077,997 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. P397P) has been classified as Likely benign.
Frequency
Consequence
NM_001110792.2 frameshift
Scores
Clinical Significance
Conservation
Publications
- chromosome Xq28 duplication syndromeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- Rett syndromeInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
- severe neonatal-onset encephalopathy with microcephalyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- syndromic X-linked intellectual disability Lubs typeInheritance: XL Classification: DEFINITIVE Submitted by: G2P
- atypical Rett syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked intellectual disability-psychosis-macroorchidism syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- systemic lupus erythematosusInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | NM_001110792.2 | MANE Select | c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC | p.Leu398AlafsTer8 | frameshift | Exon 3 of 3 | NP_001104262.1 | ||
| MECP2 | NM_004992.4 | MANE Plus Clinical | c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC | p.Leu386AlafsTer8 | frameshift | Exon 4 of 4 | NP_004983.1 | ||
| MECP2 | NM_001316337.2 | c.876_921delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC | p.Leu293AlafsTer8 | frameshift | Exon 5 of 5 | NP_001303266.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MECP2 | ENST00000453960.7 | TSL:1 MANE Select | c.1191_1236delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC | p.Leu398AlafsTer8 | frameshift | Exon 3 of 3 | ENSP00000395535.2 | ||
| MECP2 | ENST00000303391.11 | TSL:1 MANE Plus Clinical | c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC | p.Leu386AlafsTer8 | frameshift | Exon 4 of 4 | ENSP00000301948.6 | ||
| MECP2 | ENST00000630151.3 | TSL:5 | c.1155_1200delCCTGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCCACC | p.Leu386AlafsTer8 | frameshift | Exon 4 of 4 | ENSP00000486089.2 |
Frequencies
GnomAD3 genomes AF: 0.0000126 AC: 1AN: 79310Hom.: 0 Cov.: 17 show subpopulations
GnomAD2 exomes AF: 0.00000567 AC: 1AN: 176334 AF XY: 0.0000155 show subpopulations
GnomAD4 exome AF: 0.00000300 AC: 3AN: 998687Hom.: 0 AF XY: 0.00000310 AC XY: 1AN XY: 322629 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000126 AC: 1AN: 79310Hom.: 0 Cov.: 17 AF XY: 0.00 AC XY: 0AN XY: 18894 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Pathogenic:3
MECP2: PVS1, PM2:Supporting
Identified in two unrelated females with Rett syndrome; however, in both published cases the c.1155_1200del46 variant was likely part of a complex allele, as one of the patients also harbored an in-frame insertion/deletion while the other had a second frameshift variant in MECP2 (PMID: 11738860, 12655490); Also reported as an isolated pathogenic variant in two unrelated females in RettBASE; however, no additional information is available regarding the phenotype or family history (PMID: 12673788); Frameshift variant predicted to result in protein truncation in a gene for which loss of function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 12655490, 16473305, 19914908, 12872250, 11738860, 12673788, Shields2024[Abstract], 39908167)
Rett syndrome Pathogenic:2
This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). Has been observed in at least 5 individuals with phenotypes consistent with MECP2-related disease (PS4). ClinVar Variation ID: 143360, PMID: 23696494, 12180070 , 16473305 This variant has been identified as a de novo occurrence in an individual with Rett syndrome without confirmation of paternity and maternity (PM6). PMID 23696494 This variant is absent from gnomAD (PM2_Supporting).
Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
This sequence change creates a premature translational stop signal (p.Leu386Alafs*8) in the MECP2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 101 amino acid(s) of the MECP2 protein. This variant is present in population databases (rs267608329, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with clinical features of Rett syndrome (PMID: 16473305, 19914908). This variant is also known as c.1152_1197del. ClinVar contains an entry for this variant (Variation ID: 143360). This variant disrupts a region of the MECP2 protein in which other variant(s) (p.Pro389*) have been determined to be pathogenic (PMID: 17089071, 17387578, 19914908, 20151026, 21982064). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic.
Syndromic X-linked intellectual disability Lubs type Pathogenic:1
Rett syndrome;C0796222:X-linked intellectual disability-psychosis-macroorchidism syndrome;C1845336:Autism, susceptibility to, X-linked 3;C1846058:Syndromic X-linked intellectual disability Lubs type;C1968556:Severe neonatal-onset encephalopathy with microcephaly Pathogenic:1
Absent from controls (or at extremely low frequency if recessive) in Genome Aggregation Database, Exome Sequencing Project, 1000 Genomes Project, or Exome Aggregation Consortium.;Null variant in a gene where loss of function (LOF) is a known mechanism of disease.;The prevalence of the variant in affected individuals is significantly increased compared to the prevalence in controls.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at