NM_001110792.2:c.1200_1220delACCTCCACCTGAGCCCGAGAG
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4
The NM_001110792.2(MECP2):c.1200_1220delACCTCCACCTGAGCCCGAGAG(p.Pro401_Ser407del) variant causes a disruptive inframe deletion change. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001110792.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1200_1220delACCTCCACCTGAGCCCGAGAG | p.Pro401_Ser407del | disruptive_inframe_deletion | Exon 3 of 3 | ENST00000453960.7 | NP_001104262.1 | |
MECP2 | NM_004992.4 | c.1164_1184delACCTCCACCTGAGCCCGAGAG | p.Pro389_Ser395del | disruptive_inframe_deletion | Exon 4 of 4 | ENST00000303391.11 | NP_004983.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000453960.7 | c.1200_1220delACCTCCACCTGAGCCCGAGAG | p.Pro401_Ser407del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_001110792.2 | ENSP00000395535.2 | ||
MECP2 | ENST00000303391.11 | c.1164_1184delACCTCCACCTGAGCCCGAGAG | p.Pro389_Ser395del | disruptive_inframe_deletion | Exon 4 of 4 | 1 | NM_004992.4 | ENSP00000301948.6 |
Frequencies
GnomAD3 genomes Cov.: 16
GnomAD4 genome Cov.: 16
ClinVar
Submissions by phenotype
Severe neonatal-onset encephalopathy with microcephaly Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant, c.1164_1184delACCTCCACCTGAGCCCGAGAG, results in the deletion of 7 amino acids of the MECP2 protein (p.Pro389_Ser395del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MECP2-related disease. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at