NM_001131016.2:c.58_81delTTACAGCAGCAGCAGCTCCAGCAG
Variant summary
Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3BS2
The NM_001131016.2(CIZ1):c.58_81delTTACAGCAGCAGCAGCTCCAGCAG(p.Leu20_Gln27del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000305 in 1,539,472 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001131016.2 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -5 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CIZ1 | NM_001131016.2 | c.58_81delTTACAGCAGCAGCAGCTCCAGCAG | p.Leu20_Gln27del | conservative_inframe_deletion | Exon 2 of 17 | ENST00000372938.10 | NP_001124488.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000329 AC: 5AN: 151978Hom.: 0 Cov.: 31
GnomAD3 exomes AF: 0.0000403 AC: 6AN: 148858Hom.: 0 AF XY: 0.0000380 AC XY: 3AN XY: 78848
GnomAD4 exome AF: 0.0000303 AC: 42AN: 1387494Hom.: 0 AF XY: 0.0000380 AC XY: 26AN XY: 684860
GnomAD4 genome AF: 0.0000329 AC: 5AN: 151978Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1AN XY: 74210
ClinVar
Submissions by phenotype
Dystonic disorder Uncertain:1
This variant, c.58_81del, results in the deletion of 8 amino acid(s) of the CIZ1 protein (p.Leu20_Gln27del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with dystonia and/or primary dystonia (PMID: 25778706, 35041927). ClinVar contains an entry for this variant (Variation ID: 581665). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at