NM_001141969.2:c.801_824delTAACAGGCGCATTGAGCGGCTCAT
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3
The NM_001141969.2(DAXX):c.801_824delTAACAGGCGCATTGAGCGGCTCAT(p.Asn268_Ile275del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as (no stars).
Frequency
Consequence
NM_001141969.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001141969.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DAXX | MANE Select | c.801_824delTAACAGGCGCATTGAGCGGCTCAT | p.Asn268_Ile275del | disruptive_inframe_deletion | Exon 3 of 8 | NP_001135441.1 | Q9UER7-1 | ||
| DAXX | c.837_860delTAACAGGCGCATTGAGCGGCTCAT | p.Asn280_Ile287del | disruptive_inframe_deletion | Exon 3 of 8 | NP_001135442.1 | B4E1C1 | |||
| DAXX | c.801_824delTAACAGGCGCATTGAGCGGCTCAT | p.Asn268_Ile275del | disruptive_inframe_deletion | Exon 3 of 8 | NP_001341.1 | Q9UER7-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DAXX | TSL:1 MANE Select | c.801_824delTAACAGGCGCATTGAGCGGCTCAT | p.Asn268_Ile275del | disruptive_inframe_deletion | Exon 3 of 8 | ENSP00000363668.5 | Q9UER7-1 | ||
| DAXX | TSL:1 | c.801_824delTAACAGGCGCATTGAGCGGCTCAT | p.Asn268_Ile275del | disruptive_inframe_deletion | Exon 3 of 8 | ENSP00000266000.6 | Q9UER7-1 | ||
| DAXX | c.837_860delTAACAGGCGCATTGAGCGGCTCAT | p.Asn280_Ile287del | disruptive_inframe_deletion | Exon 3 of 8 | ENSP00000516212.1 | B4E1C1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at