NM_001171.6:c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001171.6(ABCC6):c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA variant causes a splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_001171.6 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- arterial calcification, generalized, of infancy, 2Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
- autosomal recessive inherited pseudoxanthoma elasticumInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine, Orphanet
- inherited pseudoxanthoma elasticumInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- arterial calcification of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001171.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC6 | NM_001171.6 | MANE Select | c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA | splice_region intron | N/A | NP_001162.5 | |||
| ABCC6 | NM_001440309.1 | c.3274-38_3274-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA | splice_region intron | N/A | NP_001427238.1 | ||||
| ABCC6 | NM_001440310.1 | c.3139-38_3139-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA | splice_region intron | N/A | NP_001427239.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ABCC6 | ENST00000205557.12 | TSL:1 MANE Select | c.3307-38_3307-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA | splice_region intron | N/A | ENSP00000205557.7 | O95255-1 | ||
| ABCC6 | ENST00000909083.1 | c.3403-38_3403-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA | splice_region intron | N/A | ENSP00000579142.1 | ||||
| ABCC6 | ENST00000909090.1 | c.3400-38_3400-3delTGGCTTCTCCTCTTCCCTCTCCCATCCATCCTTCTCinsAGA | splice_region intron | N/A | ENSP00000579149.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at