NM_001171.6:c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC

Variant names:

• chr16-16157674-CGTGGATCTTGAAGGACACGCCCTGCACAGCCAGCGGGAGCTCAGGTCG-C
• rs74315128
• NM_001171.6:c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_001171.6(ABCC6):​c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC​(p.Arg1275_His1290del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 31)
• Consequence: ABCC6 NM_001171.6 conservative_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 9.09
• Publications: 0 publications found

Genes affected

ABCC6 (HGNC:57): (ATP binding cassette subfamily C member 6) The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]

ABCC6 Gene-Disease associations (from GenCC):

• arterial calcification, generalized, of infancy, 2

  Inheritance: AR Classification: DEFINITIVE Submitted by: G2P
• autosomal recessive inherited pseudoxanthoma elasticum

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Laboratory for Molecular Medicine, Orphanet, Labcorp Genetics (formerly Invitae), G2P
• arterial calcification of infancy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001171.6.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001171.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC6	NM_001171.6	MANE Select	c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC	p.Arg1275_His1290del	conservative_inframe_deletion	Exon 27 of 31	NP_001162.5
	ABCC6	NM_001440309.1		c.3790_3837delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC	p.Arg1264_His1279del	conservative_inframe_deletion	Exon 27 of 31	NP_001427238.1
	ABCC6	NM_001440310.1		c.3655_3702delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC	p.Arg1219_His1234del	conservative_inframe_deletion	Exon 26 of 30	NP_001427239.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ABCC6	ENST00000205557.12	TSL:1 MANE Select	c.3823_3870delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC	p.Arg1275_His1290del	conservative_inframe_deletion	Exon 27 of 31	ENSP00000205557.7
	ABCC6	ENST00000909083.1		c.3919_3966delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC	p.Arg1307_His1322del	conservative_inframe_deletion	Exon 28 of 32	ENSP00000579142.1
	ABCC6	ENST00000909090.1		c.3916_3963delCGACCTGAGCTCCCGCTGGCTGTGCAGGGCGTGTCCTTCAAGATCCAC	p.Arg1306_His1321del	conservative_inframe_deletion	Exon 28 of 32	ENSP00000579149.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	Autosomal recessive inherited pseudoxanthoma elasticum (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.1
Mutation Taster		=7/193	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs74315128; hg19: chr16-16251531;