NM_001267550.2:c.34119_34139delGGAAGAGGAAGTTCTACCTGA
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP6
The NM_001267550.2(TTN):c.34119_34139delGGAAGAGGAAGTTCTACCTGA(p.Glu11374_Glu11380del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000125 in 151,720 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. E11373E) has been classified as Likely benign.
Frequency
Consequence
NM_001267550.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TTN | NM_001267550.2 | c.34119_34139delGGAAGAGGAAGTTCTACCTGA | p.Glu11374_Glu11380del | disruptive_inframe_deletion | Exon 146 of 363 | ENST00000589042.5 | NP_001254479.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TTN | ENST00000589042.5 | c.34119_34139delGGAAGAGGAAGTTCTACCTGA | p.Glu11374_Glu11380del | disruptive_inframe_deletion | Exon 146 of 363 | 5 | NM_001267550.2 | ENSP00000467141.1 |
Frequencies
GnomAD3 genomes AF: 0.000125 AC: 19AN: 151600Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000117 AC: 29AN: 248482 AF XY: 0.000119 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000776 AC: 113AN: 1456772Hom.: 0 AF XY: 0.0000828 AC XY: 60AN XY: 724486 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.000125 AC: 19AN: 151720Hom.: 0 Cov.: 32 AF XY: 0.000121 AC XY: 9AN XY: 74194 show subpopulations
ClinVar
Submissions by phenotype
not provided Uncertain:1Benign:1
This variant is associated with the following publications: (PMID: 27535533) -
- -
Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Uncertain:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at