NM_001267550.2:c.49296_49315delTGTTGGTGAACCAGTTCAGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_001267550.2(TTN):​c.49296_49315delTGTTGGTGAACCAGTTCAGG​(p.Val16433LeufsTer10) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

TTN
NM_001267550.2 frameshift

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 9.94

Publications

0 publications found
Variant links:
Genes affected
TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 2-178614081-GCCTGAACTGGTTCACCAACA-G is Pathogenic according to our data. Variant chr2-178614081-GCCTGAACTGGTTCACCAACA-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 179375.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TTNNM_001267550.2 linkc.49296_49315delTGTTGGTGAACCAGTTCAGG p.Val16433LeufsTer10 frameshift_variant Exon 262 of 363 ENST00000589042.5 NP_001254479.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TTNENST00000589042.5 linkc.49296_49315delTGTTGGTGAACCAGTTCAGG p.Val16433LeufsTer10 frameshift_variant Exon 262 of 363 5 NM_001267550.2 ENSP00000467141.1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
Jun 27, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). This variant has not been reported in the literature in individuals with TTN-related conditions. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the TTN gene (p.Val16433Leufs*10). While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein.

Cardiomyopathy Pathogenic:1
Nov 29, 2019
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant summary: TTN c.41592_41611del20 (p.Val13865LeufsX10) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. The variant was absent in 247414 control chromosomes (gnomAD). To our knowledge, no occurrence of c.41592_41611del20 in individuals affected with Cardiomyopathy and no experimental evidence demonstrating its impact on protein function have been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as likely pathogenic.

Primary dilated cardiomyopathy Pathogenic:1
Nov 01, 2013
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The Val13865fs variant in TTN has not been reported in individuals with cardimoy opathy or in large population studies. This frameshift variant is predicted to a lter the protein?s amino acid sequence beginning at position 13865 and lead to a premature termination codon 10 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein which is strongly associated with DCM (Herman 2012). In summary, this variant is likely pathogenic, though ad ditional studies are required to fully establish its clinical significance.

Cardiovascular phenotype Pathogenic:1
Dec 18, 2018
Ambry Genetics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.22101_22120del20 variant, located in coding exon 89 of the TTN gene, results from a deletion of 20 nucleotides at nucleotide positions 22101 to 22120, causing a translational frameshift with a predicted alternate stop codon (p.V7368Lfs*10). This exon is located in the A-band region of the N2-B isoform of the titin protein and is constitutively expressed in TTN transcripts (percent spliced in or PSI 100%). While truncating variants in TTN are present in 1-3% of the general population, truncating variants in the A-band are the most common cause of dilated cardiomyopathy (DCM) (Herman DS et al. N. Engl. J. Med. 2012 Feb;366:619-28; Roberts AM et al. Sci Transl Med. 2015 Jan;7:270ra6). TTN truncating variants encoded in constitutive exons (PSI >90%) have been found to be significantly associated with DCM regardless of their position in titin (Schafer S et al. Nat. Genet. 2017 Jan;49:46-53). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic.

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs727504825; hg19: chr2-179478808; API