NM_001267550.2:c.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_001267550.2(TTN):​c.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT​(p.Leu19857PhefsTer3) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

TTN
NM_001267550.2 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:2U:1

Conservation

PhyloP100: 9.27

Publications

0 publications found
Variant links:
Genes affected
TTN (HGNC:12403): (titin) This gene encodes a large abundant protein of striated muscle. The product of this gene is divided into two regions, a N-terminal I-band and a C-terminal A-band. The I-band, which is the elastic part of the molecule, contains two regions of tandem immunoglobulin domains on either side of a PEVK region that is rich in proline, glutamate, valine and lysine. The A-band, which is thought to act as a protein-ruler, contains a mixture of immunoglobulin and fibronectin repeats, and possesses kinase activity. An N-terminal Z-disc region and a C-terminal M-line region bind to the Z-line and M-line of the sarcomere, respectively, so that a single titin molecule spans half the length of a sarcomere. Titin also contains binding sites for muscle associated proteins so it serves as an adhesion template for the assembly of contractile machinery in muscle cells. It has also been identified as a structural protein for chromosomes. Alternative splicing of this gene results in multiple transcript variants. Considerable variability exists in the I-band, the M-line and the Z-disc regions of titin. Variability in the I-band region contributes to the differences in elasticity of different titin isoforms and, therefore, to the differences in elasticity of different muscle types. Mutations in this gene are associated with familial hypertrophic cardiomyopathy 9, and autoantibodies to titin are produced in patients with the autoimmune disease scleroderma. [provided by RefSeq, Feb 2012]
TTN-AS1 (HGNC:44124): (TTN antisense RNA 1) This gene encodes a non-coding RNA transcribed from the opposite strand to the titin gene. [provided by RefSeq, Aug 2016]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 2-178592434-T-TAAAGAATAAATTCCACCATCTTCATGGGCAGCATTACGAA is Pathogenic according to our data. Variant chr2-178592434-T-TAAAGAATAAATTCCACCATCTTCATGGGCAGCATTACGAA is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 404714.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TTNNM_001267550.2 linkc.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT p.Leu19857PhefsTer3 frameshift_variant, stop_gained Exon 301 of 363 ENST00000589042.5 NP_001254479.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TTNENST00000589042.5 linkc.59531_59570dupTTCGTAATGCTGCCCATGAAGATGGTGGAATTTATTCTTT p.Leu19857PhefsTer3 frameshift_variant, stop_gained Exon 301 of 363 5 NM_001267550.2 ENSP00000467141.1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
35
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:2Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Autosomal recessive limb-girdle muscular dystrophy type 2J;C1858763:Dilated cardiomyopathy 1G Pathogenic:1
Aug 16, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. This variant is located in the A band of TTN (PMID: 25589632). Truncating variants in this region are significantly overrepresented in patients affected with dilated cardiomyopathy (PMID: 25589632). Truncating variants in this region have also been reported in individuals affected with autosomal recessive centronuclear myopathy (PMID: 23975875). ClinVar contains an entry for this variant (Variation ID: 404714). This variant has not been reported in the literature in individuals affected with TTN-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu19857Phefs*3) in the TTN gene. While this is not anticipated to result in nonsense mediated decay, it is expected to create a truncated TTN protein. -

Dilated cardiomyopathy 1G Pathogenic:1
May 16, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change duplicates 40 nucleotides in exon 301 of the TTN mRNA (c.59531_59570dup), causing a frameshift at codon 19857. This creates a premature translational stop signal (p.Leu19857Phefs*3) and is expected to result in an absent or disrupted protein product. This variant is found in the A-band of this gene. While this particular variant has not been reported in the literature, truncating variants in the A-band of TTN are significantly overrepresented in patients with dilated cardiomyopathy and are considered to be likely pathogenic for the disease (PMID: 25589632). For these reasons, this variant has been classified as Likely Pathogenic. -

not provided Uncertain:1
Feb 06, 2017
Stanford Center for Inherited Cardiovascular Disease, Stanford University
Significance:Uncertain significance
Review Status:no assertion criteria provided
Collection Method:provider interpretation

Genetic testing for our patient was performed at Invitae. Given the lack of information on LVNC seen with this gene and variant type, what we know about TTN truncating variants in the general population, and lack of case data, we consider this variant a variant of uncertain significance - likely disease causing, and we do not feel it is suitable for assessing risk in healthy relatives ("predictive genetic testing") at this time. This is a novel variant and has not been reported in the literature. There are no ClinVar entry for this variant. Of note, there is limited literature associating the TTN gene with LVNC. TTN encodes titin (also known as connectin), the largest protein in humans; titin plays a critical role in the elastic properties of the sarcomere. Two titin molecules span the sarcomere, anchored at the Z-line and M-line. TTN variants have been shown by Herman et al. (2012) to be present in 27% of patients with familial dilated cardiomyopathy (DCM) versus approximately 1% of patients with hypertrophic cardiomyopathy (HCM) and 3% of controls (indicating that not all such variants are disease-causing). In addition, Norton et al. (2013) showed that not all truncating variants in TTN segregate with disease (DCM) in affected families—pointing to the difficulty in determining variant pathogenicity for a specific truncating variant. Norton et al., identified 6 TTN truncating variants carried by individuals affected with DCM in 7 of 17 DCM families (logarithm of odds, 2.99); 2 of these 7 families also had novel missense variants that segregated with disease. Two additional novel truncating TTN variants did not segregate with DCM. Roberts et al, 2015 performed cardiac phenotyping of 5267 affected and unaffected individuals as well as TTN DNA sequencing and RNA and protein analyses heart tissue. They have a resource at cardiodb.org/titin that lists the relative inclusion of TTN exons in different isoforms and provides information to guide assessment of pathogenicity of specific truncation variants in the gene. Variants located in the A-band and present in cardiac isoforms of the protein were enriched in DCM patients versus controls. The genomic coordinates for this variant are Chr2:179457162_179457201dup. LRG exon number is 300, N2BA transcript is 250. It is located in the A-band, 100% spliced in, in an Fibronectin type-III 31 domain. This variant is not present in the Genome Aggregation Data set (gnomAD; http://www.gnomad.broadinstitute.org), which currently includes variant calls on >140,000 unrelated individuals of African, Asian, European, Ashkenazi, Latino descent. However, it should be noted that deletions and duplications of this size might not be well represented in the database due to technical sequencing limitations. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1064792914; hg19: chr2-179457161; API