NM_001370259.2:c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_001370259.2(MEN1):​c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG​(p.Glu469ArgfsTer98) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. E468E) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 34)

Consequence

MEN1
NM_001370259.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 0.251

Publications

0 publications found
Variant links:
Genes affected
MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]
MEN1 Gene-Disease associations (from GenCC):
  • multiple endocrine neoplasia type 1
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Orphanet, Ambry Genetics
  • familial isolated hyperparathyroidism
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • pituitary gigantism
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • hereditary pheochromocytoma-paraganglioma
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 90 pathogenic variants in the truncated region.
PP5
Variant 11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT is Pathogenic according to our data. Variant chr11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT is described in ClinVar as Pathogenic. ClinVar VariationId is 403843.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MEN1NM_001370259.2 linkc.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG p.Glu469ArgfsTer98 frameshift_variant Exon 10 of 10 ENST00000450708.7 NP_001357188.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MEN1ENST00000450708.7 linkc.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG p.Glu469ArgfsTer98 frameshift_variant Exon 10 of 10 5 NM_001370259.2 ENSP00000394933.3

Frequencies

GnomAD3 genomes
Cov.:
34
GnomAD4 exome
Cov.:
43
GnomAD4 genome
Cov.:
34

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Multiple endocrine neoplasia, type 1 Pathogenic:1
Jun 11, 2016
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change inserts 23 nucleotides in exon 10 of the MEN1 mRNA (c.1382_1404dup), causing a frameshift at codon 469. This creates a premature translational stop signal in the last exon of the MEN1 mRNA (p.Glu469Argfs*98). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated MEN1 protein, eliminating 142 C-terminal amino acid residues. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a MEN1-related disease. In summary, this is a novel variant that truncates an important functional domain in MEN1. For this reason, it has been classified as Pathogenic. This frameshift truncates the functionally conserved nuclear localization signal of the MEN1 protein. Experimental studies have shown that disruption of this region abrogates the ability of MEN1 to bind DNA, regulate target gene expression, and inhibit cell proliferation (PMID: 15331604, 16449969). In addition, a different frameshift variant (p.Arg516Glyfs*43) with a premature termination codon downstream of this frameshift has been reported to be a common cause of multiple endocrine neoplasia type 1 (PMID: 17879353) -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.25
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555163780; hg19: chr11-64572234; API