NM_001377405.1:c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC
Variant summary
Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3BS2
The NM_001377405.1(ATXN7):c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC(p.Gln32_Gln39dup) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.000373 in 144,718 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001377405.1 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia 7Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
- spinocerebellar ataxia type 7Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001377405.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATXN7 | NM_001377405.1 | MANE Select | c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln32_Gln39dup | disruptive_inframe_insertion | Exon 3 of 13 | NP_001364334.1 | O15265-1 | |
| ATXN7 | NM_001177387.1 | c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln32_Gln39dup | disruptive_inframe_insertion | Exon 2 of 13 | NP_001170858.1 | O15265-2 | ||
| ATXN7 | NM_000333.4 | c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln32_Gln39dup | disruptive_inframe_insertion | Exon 3 of 13 | NP_000324.1 | O15265-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATXN7 | ENST00000674280.1 | MANE Select | c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln32_Gln39dup | disruptive_inframe_insertion | Exon 3 of 13 | ENSP00000501377.1 | O15265-1 | |
| ATXN7 | ENST00000295900.10 | TSL:1 | c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln32_Gln39dup | disruptive_inframe_insertion | Exon 3 of 13 | ENSP00000295900.6 | O15265-1 | |
| ATXN7 | ENST00000522345.2 | TSL:2 | c.95_118dupAGCAGCAGCAGCAGCAGCAGCAGC | p.Gln32_Gln39dup | disruptive_inframe_insertion | Exon 1 of 12 | ENSP00000428067.2 | O15265-2 |
Frequencies
GnomAD3 genomes AF: 0.000366 AC: 53AN: 144616Hom.: 0 Cov.: 23 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000185 AC: 174AN: 942420Hom.: 0 Cov.: 26 AF XY: 0.000177 AC XY: 79AN XY: 446582 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000373 AC: 54AN: 144718Hom.: 0 Cov.: 23 AF XY: 0.000298 AC XY: 21AN XY: 70412 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at