NM_001430120.1:c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM1BP3
The NM_001430120.1(POLGARF):c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Ala63_Ala71del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. A63A) has been classified as Likely benign.
Frequency
Consequence
NM_001430120.1 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal dominant 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- mitochondrial DNA depletion syndrome 4aInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
- sensory ataxic neuropathy, dysarthria, and ophthalmoparesisInheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics
- autosomal dominant progressive external ophthalmoplegiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive progressive external ophthalmoplegiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mitochondrial neurogastrointestinal encephalomyopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- recessive mitochondrial ataxia syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- spinocerebellar ataxia with epilepsyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- Leigh syndromeInheritance: AR Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001430120.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLGARF | MANE Select | c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Ala63_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | NP_001417049.1 | A0A3B3IS91 | ||
| POLG | MANE Select | c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln45_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | NP_002684.1 | P54098 | ||
| POLG | c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln45_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | NP_001119603.1 | P54098 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| POLGARF | MANE Select | c.187_213delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Ala63_Ala71del | conservative_inframe_deletion | Exon 1 of 2 | ENSP00000516626.1 | A0A3B3IS91 | ||
| POLG | TSL:1 MANE Select | c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln45_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | ENSP00000268124.5 | P54098 | ||
| POLG | TSL:1 | c.132_158delGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln45_Gln53del | disruptive_inframe_deletion | Exon 2 of 23 | ENSP00000399851.2 | P54098 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000484 AC: 7AN: 1446396Hom.: 0 AF XY: 0.00000695 AC XY: 5AN XY: 719198 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 30
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.