NM_001754.5:c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001754.5(RUNX1):c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT(p.Ser389_Pro395dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★★).
Frequency
Consequence
NM_001754.5 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000212 AC: 3AN: 1413792Hom.: 0 Cov.: 35 AF XY: 0.00000143 AC XY: 1AN XY: 698852
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of 7 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -
Hereditary thrombocytopenia and hematologic cancer predisposition syndrome Uncertain:1
NM_001754.5(RUNX1):c.1166_1186dup (p.Pro395_Phe396insSerGlnAlaGlnGlyGlyPro) is an in-frame duplication variant which is predicted to cause a change in the length of the protein by duplicating 7 amino acids (p.S389_P395dup) in a nonrepeat region but not the runt homology domain (PM4 is not met). The splice site predictor SpliceAI indicated that the variant has no impact on splicing. This variant is absent from gnomAD v2 and v3 (PM2_supporting) and has not been reported in the literature. In summary, this variant meets the criteria to be classified as a variant of uncertain significance for autosomal dominant hereditary thrombocytopenia and hematologic cancer predisposition syndrome based on the ACMG/AMP criteria applied, as specified by the ClinGen Myeloid Malignancy VCEP: PM2_supporting. -
Hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1 Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 409806). This variant has not been reported in the literature in individuals affected with RUNX1-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.1166_1186dup, results in the insertion of 7 amino acid(s) of the RUNX1 protein (p.Ser389_Pro395dup), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at