NM_001904.4:c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001904.4(CTNNB1):c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC(p.Leu159MetfsTer13) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001904.4 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- exudative vitreoretinopathyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
- severe intellectual disability-progressive spastic diplegia syndromeInheritance: AD, Unknown Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Labcorp Genetics (formerly Invitae), Illumina, G2P, Ambry Genetics
- exudative vitreoretinopathy 7Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| CTNNB1 | NM_001904.4 | c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC | p.Leu159MetfsTer13 | frameshift_variant, stop_gained | Exon 4 of 15 | ENST00000349496.11 | NP_001895.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| CTNNB1 | ENST00000349496.11 | c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC | p.Leu159MetfsTer13 | frameshift_variant, stop_gained | Exon 4 of 15 | 1 | NM_001904.4 | ENSP00000344456.5 | ||
| CTNNB1 | ENST00000645982.1 | c.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC | p.Leu159MetfsTer13 | frameshift_variant, stop_gained | Exon 4 of 16 | ENSP00000494845.1 | ||||
| CTNNB1 | ENST00000715152.1 | n.427_470dupCAAGATGATGCAGAACTTGCCACACGTGCAATCCCTGAACTGAC | non_coding_transcript_exon_variant | Exon 4 of 16 | ENSP00000520353.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Severe intellectual disability-progressive spastic diplegia syndrome Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at